ID: 1049223252_1049223260

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1049223252 1049223260
Species Human (GRCh38) Human (GRCh38)
Location 8:141437233-141437255 8:141437247-141437269
Sequence CCCTGCCCGCCGTGGGGAGCTGT GGGAGCTGTGGGTCCCGGCCTGG
Strand - +
Off-target summary {0: 7, 1: 1, 2: 5, 3: 21, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!