ID: 1049265169_1049265173

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1049265169 1049265173
Species Human (GRCh38) Human (GRCh38)
Location 8:141664042-141664064 8:141664058-141664080
Sequence CCTGCTGGGGCTGGATGTGGCCT GTGGCCTCCCTGCTGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 398} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!