ID: 1049331928_1049331934

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1049331928 1049331934
Species Human (GRCh38) Human (GRCh38)
Location 8:142059227-142059249 8:142059240-142059262
Sequence CCACACCAAACTGCAGGGTGCGG CAGGGTGCGGGGTAGAGGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!