ID: 1049337806_1049337819

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1049337806 1049337819
Species Human (GRCh38) Human (GRCh38)
Location 8:142095850-142095872 8:142095885-142095907
Sequence CCCCTTGGGGTGTCTAGGGGGCA TGCAGGAGGGCAGGGTATGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!