ID: 1049343876_1049343888

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1049343876 1049343888
Species Human (GRCh38) Human (GRCh38)
Location 8:142128291-142128313 8:142128323-142128345
Sequence CCCACACTATCCAGTGTATGGGC CGGGGGACGCAGGCCAGGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!