ID: 1049344626_1049344640

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1049344626 1049344640
Species Human (GRCh38) Human (GRCh38)
Location 8:142131889-142131911 8:142131922-142131944
Sequence CCCCCACCTTCCCTCCTGTGCCC CGGAGGCCATGCTGTGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 144, 4: 1161} {0: 1, 1: 0, 2: 0, 3: 21, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!