ID: 1049358868_1049358872

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1049358868 1049358872
Species Human (GRCh38) Human (GRCh38)
Location 8:142202372-142202394 8:142202394-142202416
Sequence CCTCTGCCAGGCAGATCAGAGCA ACTGCTCCCACCTCTGAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!