ID: 1049358869_1049358870

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1049358869 1049358870
Species Human (GRCh38) Human (GRCh38)
Location 8:142202378-142202400 8:142202392-142202414
Sequence CCAGGCAGATCAGAGCACTGCTC GCACTGCTCCCACCTCTGAGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!