ID: 1049368588_1049368597

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049368588 1049368597
Species Human (GRCh38) Human (GRCh38)
Location 8:142252830-142252852 8:142252845-142252867
Sequence CCCCTCCCCACCCCTCAGCCATT CAGCCATTTCCTCTGCACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 119, 4: 1167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!