ID: 1049388864_1049388872

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1049388864 1049388872
Species Human (GRCh38) Human (GRCh38)
Location 8:142357995-142358017 8:142358020-142358042
Sequence CCATCACTGCAAAGGGCGGCGGG CTGCTGGGTTTCAGGACAAGGGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 20, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!