ID: 1049388875_1049388887

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1049388875 1049388887
Species Human (GRCh38) Human (GRCh38)
Location 8:142358048-142358070 8:142358080-142358102
Sequence CCAGCGGCCATCACTGCAAAGGG CTGCTGGGTTTCAGGACAAGGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 0, 3: 15, 4: 123} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!