ID: 1049403374_1049403380

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1049403374 1049403380
Species Human (GRCh38) Human (GRCh38)
Location 8:142440807-142440829 8:142440820-142440842
Sequence CCTCCTGCCCTCTGTCTACCCAG GTCTACCCAGCTCCCAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 578} {0: 1, 1: 0, 2: 1, 3: 27, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!