ID: 1049409027_1049409033

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1049409027 1049409033
Species Human (GRCh38) Human (GRCh38)
Location 8:142464242-142464264 8:142464264-142464286
Sequence CCCCGCTGCTACTGCTGCTGCTG GCTGCTGGGACGCCGCGCGCGGG
Strand - +
Off-target summary {0: 2, 1: 16, 2: 88, 3: 283, 4: 963} {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!