ID: 1049427976_1049427989

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1049427976 1049427989
Species Human (GRCh38) Human (GRCh38)
Location 8:142545721-142545743 8:142545760-142545782
Sequence CCTGCTTCCCTCTGTGTCTCCAG CCCCCGAAGGGAGCCTAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!