ID: 1049438068_1049438073

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1049438068 1049438073
Species Human (GRCh38) Human (GRCh38)
Location 8:142596830-142596852 8:142596865-142596887
Sequence CCTTGACAGTGGGTGGCCAGGAC TCTGGTCTGCCCAAGCTCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!