ID: 1049442011_1049442014

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1049442011 1049442014
Species Human (GRCh38) Human (GRCh38)
Location 8:142613871-142613893 8:142613884-142613906
Sequence CCCGTGGACTCCAGGCGGTCGGC GGCGGTCGGCCCAGCGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72} {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!