ID: 1049451801_1049451808

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049451801 1049451808
Species Human (GRCh38) Human (GRCh38)
Location 8:142666023-142666045 8:142666038-142666060
Sequence CCCTCTGCTCTTCCCGGCAGCCG GGCAGCCGGCTTGGAGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174} {0: 1, 1: 0, 2: 2, 3: 22, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!