ID: 1049462530_1049462532

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1049462530 1049462532
Species Human (GRCh38) Human (GRCh38)
Location 8:142736735-142736757 8:142736752-142736774
Sequence CCTGCACATCCAGAACTGCCTCC GCCTCCTTGCCGCTGCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 285} {0: 1, 1: 1, 2: 2, 3: 38, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!