ID: 1049462530_1049462541

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1049462530 1049462541
Species Human (GRCh38) Human (GRCh38)
Location 8:142736735-142736757 8:142736779-142736801
Sequence CCTGCACATCCAGAACTGCCTCC CCACCTTGAGCCAGAGTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 285} {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!