ID: 1049465857_1049465865

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1049465857 1049465865
Species Human (GRCh38) Human (GRCh38)
Location 8:142751019-142751041 8:142751040-142751062
Sequence CCCGGCCCTGCCCGCCTTCTGTG TGCCCACTGACCTATCTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 472} {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!