ID: 1049471752_1049471761

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1049471752 1049471761
Species Human (GRCh38) Human (GRCh38)
Location 8:142777829-142777851 8:142777860-142777882
Sequence CCTCCGCCCACTCGCCCGCGCCG GTCGGCCGGCACCAGCCTTGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 51, 4: 518} {0: 1, 1: 0, 2: 1, 3: 3, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!