ID: 1049478240_1049478246

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1049478240 1049478246
Species Human (GRCh38) Human (GRCh38)
Location 8:142806804-142806826 8:142806833-142806855
Sequence CCTGTCTAGGGTAGGCTTAGCTT GTGGCAGAGCCAAGGTGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!