ID: 1049482762_1049482777

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1049482762 1049482777
Species Human (GRCh38) Human (GRCh38)
Location 8:142834772-142834794 8:142834814-142834836
Sequence CCCGAAAGTTCCAGAAAGCGGGT GCTCAGATGGCTGGAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 95} {0: 1, 1: 0, 2: 1, 3: 34, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!