ID: 1049487231_1049487242

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1049487231 1049487242
Species Human (GRCh38) Human (GRCh38)
Location 8:142872749-142872771 8:142872799-142872821
Sequence CCGCCTCCAGAATTCATAGGCTG AGCAGGGCCGGGCCTTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 245} {0: 1, 1: 0, 2: 0, 3: 24, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!