ID: 1049488098_1049488108

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1049488098 1049488108
Species Human (GRCh38) Human (GRCh38)
Location 8:142876847-142876869 8:142876874-142876896
Sequence CCAGGCCCAGCCGCTCTCCAAAA CCAAGTTGCTGGCTGCGGGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 20, 4: 224} {0: 1, 1: 1, 2: 0, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!