ID: 1049531866_1049531869

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1049531866 1049531869
Species Human (GRCh38) Human (GRCh38)
Location 8:143159145-143159167 8:143159166-143159188
Sequence CCCATGCACGTGCGTGCACACAC ACACACACAAACACACACACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 51, 4: 300} {0: 16, 1: 1592, 2: 2748, 3: 4227, 4: 7201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!