ID: 1049532293_1049532311

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1049532293 1049532311
Species Human (GRCh38) Human (GRCh38)
Location 8:143160491-143160513 8:143160534-143160556
Sequence CCGCTCCCTCCCTCGCGGCGCCC GCGGCCCCCTACCCAGGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 729} {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!