ID: 1049547524_1049547527

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1049547524 1049547527
Species Human (GRCh38) Human (GRCh38)
Location 8:143240453-143240475 8:143240467-143240489
Sequence CCACAGCTGTTGCCTGTGCCAGC TGTGCCAGCCGCTGCGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 303} {0: 1, 1: 0, 2: 1, 3: 27, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!