ID: 1049547526_1049547536

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1049547526 1049547536
Species Human (GRCh38) Human (GRCh38)
Location 8:143240465-143240487 8:143240498-143240520
Sequence CCTGTGCCAGCCGCTGCGGAGAA GGCACAGGGCACCAGGGCGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 45, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!