ID: 1049552495_1049552501

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1049552495 1049552501
Species Human (GRCh38) Human (GRCh38)
Location 8:143267079-143267101 8:143267096-143267118
Sequence CCTGGAGTGCACGGAGGGGCCGC GGCCGCGGGCAGCGTGGGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 53, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!