ID: 1049554251_1049554259

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1049554251 1049554259
Species Human (GRCh38) Human (GRCh38)
Location 8:143274329-143274351 8:143274349-143274371
Sequence CCGGTCCAGAGCAGCACTGCAGG AGGATGCTGGGGCATGGAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 100, 4: 864}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!