ID: 1049554467_1049554482

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1049554467 1049554482
Species Human (GRCh38) Human (GRCh38)
Location 8:143275171-143275193 8:143275209-143275231
Sequence CCCTCCTCCTCCTGCATCCCCTA GCCTGGTTGGAGCTGTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 142, 4: 1140} {0: 1, 1: 0, 2: 1, 3: 13, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!