ID: 1049570633_1049570644

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1049570633 1049570644
Species Human (GRCh38) Human (GRCh38)
Location 8:143368840-143368862 8:143368878-143368900
Sequence CCCACTCAGGAGGGACAGTCGGG TCAGGAGCCCGCGGCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 190} {0: 1, 1: 0, 2: 1, 3: 22, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!