ID: 1049585383_1049585397

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1049585383 1049585397
Species Human (GRCh38) Human (GRCh38)
Location 8:143430476-143430498 8:143430490-143430512
Sequence CCCCCCCCTGCTCCCCGCGGGCG CCGCGGGCGGCGGTCCCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 500} {0: 1, 1: 0, 2: 2, 3: 27, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!