ID: 1049585460_1049585470

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1049585460 1049585470
Species Human (GRCh38) Human (GRCh38)
Location 8:143430689-143430711 8:143430708-143430730
Sequence CCGCGCCCCACCCGCGCCGCCGG CCGGCCGGCCCCGCCTCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 891} {0: 1, 1: 0, 2: 10, 3: 84, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!