ID: 1049585464_1049585470

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1049585464 1049585470
Species Human (GRCh38) Human (GRCh38)
Location 8:143430695-143430717 8:143430708-143430730
Sequence CCCACCCGCGCCGCCGGCCGGCC CCGGCCGGCCCCGCCTCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 411} {0: 1, 1: 0, 2: 10, 3: 84, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!