ID: 1049587589_1049587603

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1049587589 1049587603
Species Human (GRCh38) Human (GRCh38)
Location 8:143439174-143439196 8:143439225-143439247
Sequence CCCAGATGGAGGGAGCGGGTGCC ACGGCTCCACGCCCCTGACGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!