ID: 1049592405_1049592417

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1049592405 1049592417
Species Human (GRCh38) Human (GRCh38)
Location 8:143468641-143468663 8:143468680-143468702
Sequence CCTGCAGGATCCAGCCGGCCTGT GGTCATAGCAGGCCACAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 137} {0: 1, 1: 0, 2: 1, 3: 33, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!