ID: 1049592604_1049592621

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1049592604 1049592621
Species Human (GRCh38) Human (GRCh38)
Location 8:143469399-143469421 8:143469447-143469469
Sequence CCAGCTGCCCACTGCAGCTGTGG CTGAAGCCCTGGGCTGGCGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 35, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!