ID: 1049610588_1049610597

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1049610588 1049610597
Species Human (GRCh38) Human (GRCh38)
Location 8:143553086-143553108 8:143553129-143553151
Sequence CCCTCGGGAGCTGCTGCCAGGCC CCTGAAGTCCCGCCCTGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 283} {0: 1, 1: 1, 2: 0, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!