ID: 1049613805_1049613811

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1049613805 1049613811
Species Human (GRCh38) Human (GRCh38)
Location 8:143567740-143567762 8:143567754-143567776
Sequence CCCAAAGCCCCGGTGCCAGGGGC GCCAGGGGCAGTGTGACCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 243} {0: 1, 1: 0, 2: 3, 3: 26, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!