ID: 1049617367_1049617373

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1049617367 1049617373
Species Human (GRCh38) Human (GRCh38)
Location 8:143581521-143581543 8:143581552-143581574
Sequence CCAGGCAAAGTCCAGGACAGGAG TGCCCCAGAGACGGAGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 251} {0: 1, 1: 1, 2: 3, 3: 40, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!