ID: 1049642523_1049642527

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1049642523 1049642527
Species Human (GRCh38) Human (GRCh38)
Location 8:143721977-143721999 8:143721993-143722015
Sequence CCTCCAATGTCCAGTTCAAATCT CAAATCTCTCGAGGACCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 225} {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!