ID: 1049651510_1049651524

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1049651510 1049651524
Species Human (GRCh38) Human (GRCh38)
Location 8:143771908-143771930 8:143771951-143771973
Sequence CCTGCTGGACGCCGCCTTCGACG GCGGTGCTGAAGGAGGTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46} {0: 1, 1: 0, 2: 4, 3: 23, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!