ID: 1049680508_1049680514

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1049680508 1049680514
Species Human (GRCh38) Human (GRCh38)
Location 8:143915907-143915929 8:143915924-143915946
Sequence CCCTCCAAGGCACCTGGCTGTGT CTGTGTGAGTGGCAGGTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 231} {0: 1, 1: 1, 2: 2, 3: 55, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!