ID: 1049693263_1049693277 |
View in Genome Browser |
Spacer: 27 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1049693263 | 1049693277 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 8:143971980-143972002 | 8:143972030-143972052 |
Sequence | CCACCCCAGGAGGTAGAGGAAAG | CACAATGCCCAGAACAGGCTGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 33, 4: 380} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |