ID: 1049706757_1049706761

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049706757 1049706761
Species Human (GRCh38) Human (GRCh38)
Location 8:144046620-144046642 8:144046635-144046657
Sequence CCCACAGGCTTCCCTGAACCCCA GAACCCCAGTGACCACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 294} {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!