ID: 1049709824_1049709833

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1049709824 1049709833
Species Human (GRCh38) Human (GRCh38)
Location 8:144058453-144058475 8:144058483-144058505
Sequence CCCAGGCCCAGGAGTGGGCAGTG CTCACAGCCTCACCTTGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 473} {0: 1, 1: 0, 2: 2, 3: 16, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!