ID: 1049709824_1049709837

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1049709824 1049709837
Species Human (GRCh38) Human (GRCh38)
Location 8:144058453-144058475 8:144058498-144058520
Sequence CCCAGGCCCAGGAGTGGGCAGTG TGAGTTGGCCCTGGAAGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 473} {0: 1, 1: 0, 2: 1, 3: 23, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!