ID: 1049731228_1049731237

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1049731228 1049731237
Species Human (GRCh38) Human (GRCh38)
Location 8:144179576-144179598 8:144179614-144179636
Sequence CCAAGACGAAGGTATTCAGCAGG GACTCAGGCCTAGCTTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 92} {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!